Review



pcfj601 (eft-3p:: mos1 transposase)  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Addgene inc pcfj601 (eft-3p:: mos1 transposase)
    Pcfj601 (Eft 3p/ Mos1 Transposase), supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcfj601 (eft-3p:: mos1 transposase)/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    pcfj601 (eft-3p:: mos1 transposase) - by Bioz Stars, 2026-03
    90/100 stars

    Images



    Similar Products

    pcfj601 (eft-3p:: mos1 transposase)  (Addgene inc)
    90
    Addgene inc pcfj601 (eft-3p:: mos1 transposase)
    Pcfj601 (Eft 3p/ Mos1 Transposase), supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcfj601 (eft-3p:: mos1 transposase)/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    pcfj601 (eft-3p:: mos1 transposase) - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    eft-3p::cas9 plasmid #46168  (Addgene inc)
    90
    Addgene inc eft-3p::cas9 plasmid #46168
    Eft 3p/Cas9 Plasmid #46168, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/eft-3p::cas9 plasmid #46168/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    eft-3p::cas9 plasmid #46168 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    eft 3p  (Addgene inc)
    92
    Addgene inc eft 3p
    Eft 3p, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/eft 3p/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    eft 3p - by Bioz Stars, 2026-03
    92/100 stars
    		  Buy from Supplier
    eft-3p::cas9 + grna plasmid  (Addgene inc)
    90
    Addgene inc eft-3p::cas9 + grna plasmid
    Eft 3p/Cas9 + Grna Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/eft-3p::cas9 + grna plasmid/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    eft-3p::cas9 + grna plasmid - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    pms79  (Addgene inc)
    92
    Addgene inc pms79

    Pms79, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pms79/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    pms79 - by Bioz Stars, 2026-03
    92/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: microPublication Biology

    Article Title: Expansion of the split hygromycin toolkit for transgene insertion in Caenorhabditis elegans

    doi: 10.17912/micropub.biology.001091

    Figure Lengend Snippet:

    Article Snippet: pMS79 , Cas9 + guide plasmid targeting ChrII landing pad , eef-1A.1 p::Cas9 + U6p::GGACAGTCCTGCCGAGGTGG , ​​ ​ , Addgene.

    Techniques: Plasmid Preparation, Generated, Marker, Clone Assay, Expressing